Quintara Biosciences

DNA Sequencing

QuintaraBio has been providing the highest quality Sanger DNA Sequencing services to the life science research community since 2005. Our mission as the leading service provider is to ensure excellent customer service, fast turnaround time, advanced technical support and offer the best value to our customers. 

SimpliSeqTM DNA Sequencing is the most commonly requested service, for plasmid DNA, PCR fragment, phage DNA, with primer premixed or unmixed.

DirectSeqTM Colony Sequencing is the best one-stop service for customers that prefer to minimize the risk of low copy number or purification quality. Just send us your bacteria colonies on agar plates or in liquid culture, and expect your data delivered to your email account within 24 hours.

QuintSeqTM On-demand Sequencing is our premium service designed to expedite the process and shorten your research cycle. After sequencing the bacterial colonies and delivering the data, we keep your colonies and plasmid for one month. During this period, we’ll send back the colony or purified plasmid based on your request without additional charge.

Benefits

  • The most flexible sequencing service with the highest success rate.
  • Skilled analysis of your sequencing results.
  • Expert troubleshooting to optimize more complex samples (hairpin, GC-rich templates).
  • Additional services (template amplification, PCR purification) are included in the service package.
  • Optional sequence editing and sequence alignment are available free of charge.

Quality

  • Average read lengths: 700-1000 bp
  • Color printouts of chromatographs are provided free of charge upon request.
  • Optional sequence alignment saves time when analyzing sequencing results.
  • Sequence editing is provided upon request. (Sequence editing means a manual proofread performed by an experienced staff to correct mistakes /uncertainties in sequences generated by the automatic base caller)
  • Troubleshooting: We propose further troubleshooting steps based on the sequencing results. It is your decision whether we continue sequencing your samples.
  • Repeat policy: Failed samples will be repeated based on our interpretation of your sequencing results. The repeat is free of charge.
Service Name Price/rxn
(rxn 1-47)*
Price/rxn (
rxn 48-96)
Price/rxn
(rxn >96)
Turnaround Time** Deliverable
SimpliSeq DNA Sequencing $6 $5 $4.50 12 Hours Analyzed data
Q-MaxSeq DNA Sequencing*** $4 $4 $4 12 Hours Analyzed data
DirectSeq Colony Sequencing $9 $8 $7.50 24 Hours Analyzed data
QuintSeq On-Demand Sequencing $12 $10 $9 24 Hours Data and plasmid
PCR Cleanup $3 $2.50 $2 1 Hour Cleaned sample
Rolling Circle Amplification $4 $3.50 $3 12 Hours Amplified Sample
Plasmid Miniprep $4 $3.50 $3 2 Hours Purified Plasmid

*For regional/promotion/academic discounted price, please contact the regional sales rep click here.

**Estimated turnaround time by sample submission before the cutoff time in different territories. Please contact the regional sales rep for actual pickup schedule click here.

*** Prepaid 96 reactions each order, flexible sample submission quantity afterwards

Sample Submission Instructions

Sample Requirements


Plasmid Samples
  • Plasmid DNA purified by commercially available kits
  • Low copy number plasmids need to be further concentrated by spin column, ETOH precipitation, or RCA before sequencing
  • Check quality and concentration of plasmid by gel electrophoresis and A260/A280
PCR Samples
  • PCR products need to be purified to eliminate primers and dNTPs
  • Check quality and concentration after purification by gel electrophoresis (2ul) confirming the presence of one specific band
  • For unpurified PCR samples, please mark as “unpurified PCR”
E. coli colonies
  • Colonies need to grow for at least 16 hours at 37°C to reach a good visible size
  • Place all samples in either tightly sealed 8-strip tubes or strip capped 96-well plate

Sample Submission Guide


Step 1 Visit www.quintarabio.com to register for an account (PO: purchase order of your lab; if you will pay your bill by credit card, just write CC).
Step 2 Log in to your Quintara account. Select “Online Form” and fill in sample information, print the order receipt upon submission.
Step 3 Prepare samples according to the instructions on this page and view our free universal primers here; if you are using one of our universal primers you do not need to add primer to your samples.
Step 4 Place your samples and order receipt in the nearest Quintara Drop Box. Exact pickup time varies depending on location (contact your local representative).

Selection Guide for Seq-A-Strip DNA Sequencing Service

Please submit sequencing samples in 8-strip PCR Tubes; if sending primer separately, send in a 1.5ml tube.


Plasmid/Purified PCR

Premixed

One set of 8-strip PCR tube:


Mixed in the same tube: Template + Primer



Premixed for success
Advantages of premixed samples:
  • Track samples easily
  • Get results faster
  • Enjoy low cost per reaction
  • Improve success rate significantly
Unpurified PCR

Unmixed

Two sets of tubes:


Tube 1: Template     Tube 2: Primer

Primer (5 pmol/μl or 5 μM), 10 μl. Or, use our free primer library.


Primer For Sequencing:
Prefer Tm: 50-60C, GC content: 40-60%

How to Label Sample Tubes

Label the samples with your initials followed by numbers



8-strip PCR tube for samples containing template
Mark the first tube near the bottom of the tube
Example: Samples from John Smith

Label on the cap as well as on the side of the tube

E. Coli Colonies

Pick a colony and resuspend in diH2O or Tris Buffer

Two sets of tubes:

Tube 1: Colony Suspension     Tube 2: Primer

  • Colonies need to grow for at least 16hrs at 37°C to reach good visible size
  • Pick a single colony with sterile tip and resuspend in 30ul sterile diH2O or Tris buffer (10mM, ph8.0), 15 ul will be submitted to us, and the rest 15 ul will be kept by clients for future uses
  • Prepare 2 separate tubes: 1 contains 15ul colony suspension, 1 contains 5ul primer at 5pmol/ul

Plasmid Walking

  • 10ug plasmid DNA
  • Vector information if whole plasmid sequencing is to be done
  • 10ul vector primers for first round of sequencing at 5uM
  • Reference or expected sequence if any

Free Primers

Available Common Primers (Complete List in Excel) || Search Online

Name Description Sequence
3'AOX1 For Pichia vectors with AOX1 terminator, reverse primer GCAAATGGCATTCTGACATCC
5'AOX1 For Pichia vectors with AOX1 promoter, forward primer GACTGGTCCAATTGACAAGC
Alpha-factor Alpha factor signal sequence, forward primer TACTATTGCCAGCATTGCTGC
Amp-R 5' end of ampiciltrn resistance gene, reverse primer ATAATACCGCGCCACATAGC
CAT-R 5' end of chloramphenicol resistance gene, reverse primer GCAACTGACTGAAATGCCTC
CMV Forward Human CMV immediate early promoter, forward primer CGCAAATGGGCGGTAGGCGTG
CRE-R 5' end of Cre recombinase, reverse primer GCAAACGGACAGAAGCATTT
EF-1a Forward Human elongation factor-1a promoter, forward primer TCAAGCCTCAGACAGTGGTTC
GAL1 S. cerevisiae GAL1 promoter, forward primer AATATACCTCTATACTTTAACGTC
Gal10pro-F S. cerevisiae GAL10 promoter, forward primer GGTGGTAATGCCATGTAATATG
Gal4 N-term 3' end of Gal4 DNA binding domain, forward primer GAGTAGTAACAAAGGTCAA
Gal4-AD 3' end of Gal4 activation domain, forward primer AATACCACTACAATGGAT
GFP-F 3' end of GFP, forward primer GGTCCTTCTTGAGTTTGTAAC
GFP-R 5' end of GFP, reverse primer CCATCTAATTCAACAAGAATTGGGACAAC
IRES-F 3' end of IRES, forward primer TGGCTCTCCTCAAGCGTATT
IRES-R 5' end of IRES, reverse primer CCTCACATTGCCAAAAGACG
LacI-R 5' end of LacI, reverse primer GGCATACTCTGCGACATCGT
LacZ-R 5' end of LacZ, reverse primer GACAGTATCGGCCTCAGGAA
M13 (-21) Forward In lacZ gene TGTAAAACGACGGCCAGT
M13 (-40) In lacZ gene GTTTTCCCAGTCACGAC
M13 Reverse In lacZ gene CAGGAAACAGCTATGAC
M13/pUC Forward In lacZ gene CCCAGTCACGACGTTGTAAAACG
M13/pUC Reverse In lacZ gene AGCGGATAACAATTTCACACAGG
pBAD Forward For vectors with E. cotr araBAD promoter, forward primer ATGCCATAGCATTTTTATCC
pBAD Reverse For vectors with E. cotr araBAD promoter, reverse primer GATTTAATCTGTATCAGG
T3 T3 promoter, forward primer GCAATTAACCCTCACTAAAGG
T7 T7 promoter, forward primer TAATACGACTCACTATAGGG
T7 Terminal T7 terminator, reverse primer GCTAGTTATTGCTCAGCGG

Specialized Services

RCA

Primer Walking

Amplicon Sequencing

Plasmid DNA Miniprep

PCR Purification

Fragment Analysis

Mutation Detection

Unknown Plasmid Sequencing

Plasmid DNA Maxiprep

Order

Redirecting