Quintara Biosciences

Our Favorite Tools

These are just a few of our favorite software packages. Please let us know if you have a favorite tool that is not listed here.


Chromotogram Viewers

For Windows and Mac OS Windows Specific
  • Chromas, Windows specific chromatogram viewer
  • BioEdit, a sequence alignment viewer and editor
Mac OS Specific

Primer Design

  • Primer3, online primer design on DNA template
  • PrimerX, automated design of mutagenic primers for site-directed mutagenesis based on DNA or protein sequence

Utilities

Other Tools


Frequently Asked Questions

Overview
I'm a new customer, how do I open an account?
What are the steps for DNA sequencing?
Why should I use Quintara Bio?
How can I test your service?
What equipment do you use?

Service Information
What is the price?
What kind of QC do you offer?
How do I confirm my order was placed?
Can I open an account and submit samples if I live outside of the U.S.?
Hours and holiday schedule?
Where and when are the pickups?

Samples
How should I prepare the samples?
How do I prepare my samples so I will get the best DNA sequencing results?
What types of DNA templates can be sequenced?
May I submit 8-strip tubes if I am submitting less than 8 samples?
Can you sequence very short (~100 bp) PCR products?
Can you help me if my sequence is GC-rich and difficult to amplify?
How much DNA and primer should I submit?
How long do you keep the samples?
How should I label my 8-strip tubes?
What do I need to provide for you to perform PCR cleanup on my samples?
Does my vector have a binding site for a universal primer?
How do I determine my DNA concentration?

Primers
What is the primer storage policy
What tips do you have for designing primers?
Can you design and order primers for me?
Where do I get primers?
What universal primers do you have?
What amount of primer is needed?

Results
How soon can I get the sequencing results?
How do I get the results?
How do I view the sequencing data?
What's the average read length?
How come the repeats work when there were no changes to the samples or primer?

Troubleshooting
What should I do about failed reactions?
What is your repeat policy?
Why did my reactions fail?
Why does a poly A-T region resulting in poor sequencing mean?
How can I optimize my reactions?

Other
Do you still have my template from order #?
Who should I talk to in regards to my invoice?
How can I pay for the service?
I have an order to pick up, not an online order.
How do I know if my sample was picked up?
I missed the drop off time; can you pick up my sample?


Overview


I'm a new customer, how do I open an account?

On our homepage, click on the “Order” or “Login” tab. Then under the log in box, click “Register”, fill in the new user registration form, then click Register User at the bottom of the page. You will now be able to log into our website, manage your account, and place orders.


What are the steps for DNA sequencing?

If you want to place an order for our DNA sequencing service, first you will need to make sure you have created an account on our website. Once you are logged into your account, you can fill an online order form, or import the order information from an Excel file.

For your sample, you will want to follow our Sample Preparation Guidelines.

Once your samples are prepared, you can ship your order to our facilities on the west or east coast. We also offer free local pickups in the Bay Area, Boston, Colorado, and Wisconsin. Contact us for our local pickup schedule and locations.


Why should I use Quintara Bio?

Quintara Bio is continuously striving to provide the highest quality DNA sequencing service, fastest turnaround times, and overall value for our customers. Our experienced staff and state-of-the-art equipment run 24/7 to provide you with the superior results you deserve and optimize the most complex reactions.

Other companies may offer lower prices for similar sequencing, but they can only do so by cutting corners, using cheap reagents, and offering no Quality Control. All too often mistakes on their part will leave you with the wrong data, or have you wasting time solving their issues by yourself.


How can I test your service?

We offer 5 free reactions to all new customers that want to try our DNA sequencing service. Just set up an online account, submit an order, and experience the quality Quintara Bio provides.


What equipment do you use?

We use ABI 3730xl DNA Analyzers, the Gold Standard for high throughput genetic analysis. Along with our experienced technicians and QC staff, we deliver the highest quality data.


Service Information


What is the price?

Our general pricing for our DNA sequencing services can be found on the DNA sequencing service page. We offer many academic and regional discounts, please contact our sales team for a more accurate quote based on your specific order.


What kind of QC do you offer?

We provide two tiers of QC, first our proprietary analytical software will check for all basic parameters of the reactions, and then the QC manager will go through each reaction in trouble shooting for reactions that are not optimal, and you will receive a personalized summary of your order. We will work closely with you to optimize any reaction that you need. Visit our Data Sample page to see the value in our service.


How do I confirm my order was placed?

Once you place your online order you will receive an automated message that will confirm your order. However if you feel the need to double check, feel free to contact us by phone or email and we are happy to ensure your order confirmation.


Can I open an account and submit samples if I live outside the US?

Of course, we serve customers from all over the globe. When you set up your online account, under the State tab, just leave it blank. Ship your samples to our Boston or San Francisco laboratory, and receive your data online.


Hours and holiday schedule?

Our lab in South San Francisco is open 24 hours Monday through Saturday every week, and our Boston facility processes orders 7 days a week. Here is our holiday schedule through the end of 2015.

  • 2015-01-01, Mon., New Year's Day
  • 2015-02-16, Mon., President's Day
  • 2015-05-25, Mon., Memorial Day
  • 2015-07-03, Fri., Independence Day
  • 2015-09-07, Mon., Labor Day
  • 2015-11-26, Thu., Thanksgiving
  • 2015-12-25, Fri., Christmas Day


Where and when are the pickups?

Our pickup schedule varies by territory. We offer free sample pickups in Boston metropolitan area, the San Francisco Bay Area, Denver, Fort Collins, Boulder, and Aurora, CO, Madison, WI, and Indianapolis, IN. Please contact us by email or phone to find out the schedule by territory.


Samples


How should I prepare the samples?

To properly prepare your samples for sequencing, please follow our guideline here.


How do I prepare my samples so I will get the best DNA sequencing results?

To improve the sequencing results of your samples, ensure that all information on the sample sheet is correct, and include any important information, e.g. hairpins or high Tm primers. In the event some reactions fail, providing excess sample can improve the turnaround time for repeat reactions.


What types of DNA templates can be sequenced?

We accept plasmids, purified and unpurified PCR, cosmid, BAC samples, and we will accept agar plates with bacterial colonies and bacterial cultures to purify the samples at our lab.


May I submit 8-strip tubes if I am submitting less than 8 samples?

Of course, we encourage the use of strip tubes over individual tubes regardless of the amount of samples.


Can you sequence very short (~100 bp) PCR products?

Yes, however we recommend sequencing PCR products that are at least 200 bp.


Can you help me if I my sequence is GC-rich and difficult to amplify?

Our experts will work closely with you to optimize complex GC-rich samples, and troubleshoot using proprietary protocols specifically designed for such cases.


How much DNA and primer should I submit?

It will depend on the type of DNA template and the size of the sample, please use our chart for submission guidelines. If you’re submitting primers, the recommend concentrations can be found on the same chart.


How long do you keep the samples?

We store all samples for one month after sequencing. We also store customer primers free of charge until completely finished.


How should I label my 8-strip tubes?

Please label each strip with your initials, and sample number on the side of each tube. We also recommend labeling the top of the tubes.


What do I need to provide for you to perform PCR cleanup on my samples?

Just submit your unpurified PCR products with primers in separate labeled tubes. We will perform the clean-up, run each samples on gel, then optimize and sequence each reaction.


Does my vector have a binding site for a universal primer?

Please look at your vector map or the manufacturer’s procedure to see which primer site is present or what primer is recommended for sequencing. We offer 5000+ free primers, check here for a list of our primers.


How do I determine my DNA concentration?

We recommend using gel electrophoresis or a spectrophotometer. If using a spectrophotometer like a NanoDrop, check the A260/A280 to ensure your sample is not contaminated.


Primers


What is the primer storage policy?

We will store all of the primers you send us free of charge upon request to use for future orders.


What tips do you have for designing primers?

It is ideal to design primers that have a GC content of 40-60% and Tm of 50-60oC.


Can you design and order primers for me?

We are happy to work with you to design primers to optimize your sequencing. We will also order your primers for you free of charge from IDT; just contact us at oligos@quintarabio.com for more info.


Where do I get primers?

We are working towards synthesizing own custom oligomers. However IDT is a great source for ordering the primers you need.


What universal primers do you have?

We offer 5000+ free primers, check here for a list of our universal primers.


What amount of primer is needed?

It will depend on the number of reactions that primer is being used for, but we will need at least 1 uL with 30ng/uL or higher concentration per reaction.


Results


How soon can I get the sequencing results?

Once we receive the samples in our lab, the average turnaround is 8 hours to complete the sequencing. It will depend on your location for the exact data delivery time, but in most cases it will be next morning delivery. We also offer an express service if you are in a rush, contact us for more info.


How do I get the results?

Data is automatically emailed once the sequencing is complete, then run through our rigorous QC procedure. You can directly download your data in a secure attachment, and you will receive a custom sequence summary from a member of our QC team.


How do I view the sequencing data?

In order to view chromatogram files, you will need to download a suitable viewer (check here). The sequence .txt file can be read with any available text software such as Microsoft Word or Notepad.


What’s the average read length?

The average read length for the sequencing instrument is 800-1000bp. For longer reads ask us about our primer walking service


How come the repeats work when there were no changes to the samples or primer?

There are always possibilities for machine or human error, however we do often change the conditions of failed reaction based on our interpretation of the original results. Please contact us if you have specific questions regarding a particular order.


Troubleshooting


What should I do about failed reactions?

There are many reasons a reaction could fail. Our QC team will closely analyze your data, and suggest the most probable reason for the reactions that failed and the best course of action, either rerun the sample, or repeat the entire reaction.


What is your repeat policy?

We will optimize samples from orders that didn’t sequence correctly and rerun them later that day. If a reaction needs to be repeated from scratch due to an error on our part, it will be done free of charge. We will ask if you want to rerun any other incomplete reactions.


Why did my reactions fail?

There are many possibilities for failed reactions, and our dedicated QC team will examine each failed reaction to determine the most likely reason for each failed reaction, and relay their findings in their personalized order summary.


What does a poly A-T region resulting in poor sequencing mean?

If a DNA sample contains a homopolymeric region such as poly A, 5 or more in concession, the enzyme can slip from the strand and result in a bad read. We would then recommend sequencing the DNA in the opposite direction to improve results.


How can I optimize my reactions?

It will largely depend on what was the reason for the poor results. We will recommend the best options for optimization based on our expertise, and work closely with you to sequence the most complex reactions.


Other


Do you still have my template from order #?

Please email us your specific order numbers, and we will quickly get back to you informing you if we still have the sample. We typically store all samples for one month.


Who should I talk to in regards to my invoice?

Please contact us by phone (1-415-738-2509) or email(info@quintarabio.com) if you have any questions about your invoice.


How can I pay for the service?

We accept payment by credit card or Purchase Order (PO). Include the PO# for your group or institution in account info.


I have an order to pick up, not an online order.

We prefer our customers to place their orders online, however if you normally submit orders offline, contact your regional account manager to arrange a pick up.


How do I know if my sample is picked up?

If you submitted your sample after the pickup time, it may not have been picked up. Please contact our lab and we will gladly check for you if we have received your samples.


I missed the drop off time; can you pick up my sample?

If you have missed your local drop-off time, we may still be able to pick it up for you. Call or email the local manager, and we will try our best to arrange a pick up.

Available Common Primers (Complete List in Excel)

Name Description Sequence
3'AOX1 For Pichia vectors with AOX1 terminator, reverse primer GCAAATGGCATTCTGACATCC
5'AOX1 For Pichia vectors with AOX1 promoter, forward primer GACTGGTCCAATTGACAAGC
Alpha-factor Alpha factor signal sequence, forward primer TACTATTGCCAGCATTGCTGC
Amp-R 5' end of ampiciltrn resistance gene, reverse primer ATAATACCGCGCCACATAGC
CAT-R 5' end of chloramphenicol resistance gene, reverse primer GCAACTGACTGAAATGCCTC
CMV Forward Human CMV immediate early promoter, forward primer CGCAAATGGGCGGTAGGCGTG
CRE-R 5' end of Cre recombinase, reverse primer GCAAACGGACAGAAGCATTT
EF-1a Forward Human elongation factor-1a promoter, forward primer TCAAGCCTCAGACAGTGGTTC
GAL1 S. cerevisiae GAL1 promoter, forward primer AATATACCTCTATACTTTAACGTC
Gal10pro-F S. cerevisiae GAL10 promoter, forward primer GGTGGTAATGCCATGTAATATG
Gal4 N-term 3' end of Gal4 DNA binding domain, forward primer GAGTAGTAACAAAGGTCAA
Gal4-AD 3' end of Gal4 activation domain, forward primer AATACCACTACAATGGAT
GFP-F 3' end of GFP, forward primer GGTCCTTCTTGAGTTTGTAAC
GFP-R 5' end of GFP, reverse primer CCATCTAATTCAACAAGAATTGGGACAAC
IRES-F 3' end of IRES, forward primer TGGCTCTCCTCAAGCGTATT
IRES-R 5' end of IRES, reverse primer CCTCACATTGCCAAAAGACG
LacI-R 5' end of LacI, reverse primer GGCATACTCTGCGACATCGT
LacZ-R 5' end of LacZ, reverse primer GACAGTATCGGCCTCAGGAA
M13 (-21) Forward In lacZ gene TGTAAAACGACGGCCAGT
M13 (-40) In lacZ gene GTTTTCCCAGTCACGAC
M13 Reverse In lacZ gene CAGGAAACAGCTATGAC
M13/pUC Forward In lacZ gene CCCAGTCACGACGTTGTAAAACG
M13/pUC Reverse In lacZ gene AGCGGATAACAATTTCACACAGG
pBAD Forward For vectors with E. cotr araBAD promoter, forward primer ATGCCATAGCATTTTTATCC
pBAD Reverse For vectors with E. cotr araBAD promoter, reverse primer GATTTAATCTGTATCAGG
T3 T3 promoter, forward primer GCAATTAACCCTCACTAAAGG
T7 T7 promoter, forward primer TAATACGACTCACTATAGGG
T7 Terminal T7 terminator, reverse primer GCTAGTTATTGCTCAGCGG